ORIGINAL ARTICLE
Ahead of print publication  

A new TEX11 mutation causes azoospermia and testicular meiotic arrest


1 Center for Reproductive Medicine, Cheeloo College of Medicine, Shandong University, Jinan 250012, China
2 Key Laboratory of Reproductive Endocrinology of Ministry of Education, Shandong University, Jinan 250012, China
3 Shandong Key Laboratory of Reproductive Medicine, Jinan 250012, China
4 Shandong Provincial Clinical Research Center for Reproductive Health, Jinan 250012, China
5 National Research Center for Assisted Reproductive Technology and Reproductive Genetics, Shandong University, Jinan 250012, China

Date of Submission22-Jul-2020
Date of Acceptance12-Jan-2021
Date of Web Publication09-Mar-2021

Correspondence Address:
Hao-Bo Zhang,
Center for Reproductive Medicine, Cheeloo College of Medicine, Shandong University, Jinan 250012; Key Laboratory of Reproductive Endocrinology of Ministry of Education, Shandong University, Jinan 250012; Shandong Key Laboratory of Reproductive Medicine, Jinan 250012; Shandong Provincial Clinical Research Center for Reproductive Health, Jinan 250012
China
Hong-Bin Liu,
Center for Reproductive Medicine, Cheeloo College of Medicine, Shandong University, Jinan 250012; Key Laboratory of Reproductive Endocrinology of Ministry of Education, Shandong University, Jinan 250012; Shandong Key Laboratory of Reproductive Medicine, Jinan 250012; Shandong Provincial Clinical Research Center for Reproductive Health, Jinan 250012; National Research Center for Assisted Reproductive Technology and Reproductive Genetics, Shandong University, Jinan 250012
China

Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/aja.aja_8_21

PMID: 33762476

  Abstract 


There are many unknown genetic factors that lead to infertility in nonobstructive azoospermia men. Here, we performed whole-exome sequencing in blood samples obtained from 40 azoospermia patients with meiotic arrest and found a novel c.151_154del (p.D51fs) frame-shift mutation in exon 3 of the testis expressed 11 (TEX11) gene in one patient. Sanger sequencing analysis of the patient and 288 fertile men was performed to validate the mutation. Immunohistochemical analysis showed TEX11 expression in late-pachytene spermatocytes and in round spermatids in fertile human testes. In contrast, testes of the patient with TEX11 mutation underwent meiotic arrest and lacked TEX11 expression. Western blotting of human embryonic kidney (HEK293) cells transfected with a vector for the p.D51fs TEX11 variant detected no TEX11 expression. In conclusion, we identified a novel frame-shift mutation in the TEX11 gene in an azoospermia patient, emphasizing that this gene should be included in genetic screening panels for the clinical evaluation of azoospermia patients.

Keywords: male infertility; meiotic arrest; nonobstructive azoospermia; testis expressed 11


Article in PDF

How to cite this URL:
Yu XC, Li MJ, Cai FF, Yang SJ, Liu HB, Zhang HB. A new TEX11 mutation causes azoospermia and testicular meiotic arrest. Asian J Androl [Epub ahead of print] [cited 2021 Aug 5]. Available from: https://www.ajandrology.com/preprintarticle.asp?id=310991

Xiao-Chen Yu, Meng-Jing Li
These authors contributed equally to this work.



  Introduction Top


Infertility impacts approximately 15% of couples, and about 50% of infertility is caused by male factors.[1],[2],[3],[4] Human spermatogenesis comprises a series of precisely regulated, continuous processes, including differentiation of spermatogonia, meiosis of spermatocytes, and sperm maturation.[5] Factors known to deleteriously impact spermatogenesis include hormonal regulation, varicocele, cryptorchidism, immune factors, environmental chemicals, and genetic factors, among others.[4],[6] Spermatogenesis disorders caused by genetic factors represent the most commonly encountered problems, accounting for 15%–30% of male infertility, and these typically manifest as severe oligospermia or azoospermia.[7],[8],[9]

The incidence of azoospermia is about 10%–15% in male infertility,[8] which can be divided into obstructive azoospermia (OA; 15%–20%)[10] and nonobstructive azoospermia (NOA; 80%–85%).[6],[11] The many etiologies of NOA include pretesticular factors such as endocrine abnormalities and testicular factors such as testicular torsion, genetic abnormalities, and idiopathic causes,[12],[13] whereas the posttesticular categories are considered to be the major contributors to OA.[14],[15] For OA patients, it is sometimes possible to restore reproductive function via surgery or other treatments,[4],[16] whereas NOA is understood as one of the most difficult diseases to treat in male infertility.[17] At present, the etiology and mechanisms of many NOA patients remain unknown, further limiting treatment options.[18] Moreover, only limited genetic tests are currently available to help determine the etiology of infertile men, including karyotyping, Y chromosome azoospermia factor (AZF) microdeletion, and cystic fibrosis transmembrane conductance regulator (CFTR) mutation screening.[6],[8] We are unaware of any established predictive tests to indicate testicular pathology and/or the possible presence of sperm cells in the testis. In this context, research into the meiotic genetic factors in male infertility, and especially in NOA patients, is very likely to further clarify the causes and mechanisms of spermatogenesis disorders and to improve the capacity of clinicians to provide individualized diagnoses as well as genetic counseling for patients.

Testis expressed 11 (TEX11) is a gene located on the X chromosome that is expressed specifically in germ cells;[1],[14],[19] it has high sequence identity in mouse and human.[10] The incidence of TEX11 gene mutations in male primary infertility is high, at about 1%, and TEX11 dysregulation has been implicated in spermatocyte apoptosis, maturation disorders, and azoospermia.[10],[20],[21] Work with Tex11-/Y-null mice has shown that the lack of TEX11 causes meiotic arrest, and TEX11 is known to regulate homologous chromosomal synapsis and the repair of DNA double-strand breaks.[21],[22] In the present study, a novel mutation of the TEX11 gene was found in an azoospermia patient based on whole-exome sequencing,[20] and we show that this mutation is causative for azoospermia and testicular meiotic arrest.


  Patients and Methods Top


Ethical approval

This study was approved by the Institutional Review Board for Reproductive Medicine of Shandong University (Jinan, China; ethical committee reference number 2019 #36), and written informed consent was obtained from each patient. All of the DNA and tissue samples were handled in accordance with the National Regulation of Clinical Sampling in China.

Patients and study population

We studied 40 NOA Chinese patients with meiotic arrest. The diagnoses in men with azoospermia were made on the basis of semen analysis, and the pathological type of meiotic arrest was confirmed by means of histologic examination of testicular biopsy specimens according to the guidelines of the World Health Organization (WHO) Laboratory Manual for the Examination and Processing of Human Semen (5th edition, 2010).[23] Any conditions that result in spermatogenic failure (e.g., chromosomal abnormalities, Y-chromosomal microdeletions, orchitis, cryptorchidism, radiotherapy, or chemotherapy) were not present among the 40 meiotic arrest patients. The patients were recruited from the Center for Reproductive Medicine of the Shandong Provincial Hospital Affiliated with Shandong University (Jinan, China).

Immunohistochemical (IHC) analysis

For histology, testicular biopsy from those azoospermia men was fixed in 4% paraformaldehyde (PFA) solution (Solarbio, Beijing, China), embedded in paraffin, and cut into 5-μm thick sections. After sectioning, the slides were rehydrated and then processed with hematoxylin and eosin staining. Testicular biopsies from a fertile patient (who underwent percutaneous testicular biopsy for oligozoospermia) and from the patient with the TEX11 mutation underwent IHC staining. A mouse-specific HRP/DAB (ABC) Detection IHC Kit (Abcam, Hong Kong, China) was used for IHC staining. Briefly, after rehydration, sections were blocked with Hydrogen Peroxide Block Reagent (Abcam) for 10 min. The sections were then boiled for 15 min in Sodium Citrate Antigen Retrieval Solution (Solarbio). After cooling to room temperature, the rest of the procedure was conducted according to the IHC Kit product protocol. Immunostaining of TEX11 was carried out using a primary polyclonal goat-anti-human TEX11 antibody (1:100 diluted, Abcam), with secondary mouse-anti-goat IgG-B antibody (1:200 diluted, Santa Cruz Biotechnology, Shanghai, China).

Whole-exome sequencing (WES) analyses

We performed WES for the 40 NOA patients with meiotic arrest. Genomic DNA was extracted from peripheral blood samples using QIAamp DNA mini kits (Qiagen, Beijing, China) following the manufacturer's instructions. Then, the samples were sent to iGeneTech company (Beijing, China) for WES analysis. Briefly, DNA samples from the peripheral blood cells were used to generate sequencing libraries with Fast Library Prep Kit (iGeneTech). Then, exons of genes were captured with the AIExome Enrichment Kit (iGeneTech). Then, SAMtools (http://www.htslib.org/), samblaster (https://github.com/GregoryFaust/samblaster), and GATK (https://gatk.broadinstitute.org/hc/en-us) were used to sort the Binary Alignment/Map (BAM) format files and for duplicate marking, local realignment, and base quality recalibration to generate final BAM file for computation of the sequence coverage and depth. The target mean depth was 147.06, and the coverage rate of samples was 99.85%. To characterize the detected variants, dbSNP (https://www.ncbi. nlm.nih.gov/snp/), 1000 Genome (https://www.internationalgenome. org/), and other related databases were applied. For exonic variants, gene transcript annotation databases, such as Ensembl (http://asia.ensembl.org/index.html) and UCSC (http://genome.ucsc.edu/), were also used to assess amino acid alterations. Minor allele frequency (MAF) values were not previously reported or reported to have a frequency below 0.1% in four public databases, including the 1000 Genome.

Validation of mutations via Sanger sequencing

To confirm the novel mutation identified in the TEX11 gene, the Sanger sequencing was performed. The TEX11 exon/intron structure was determined by alignment of the TEX11 cDNA sequence (NM_031276) with its genomic sequence.[24] Exon 3 of the human TEX11 gene was polymerase chain reaction (PCR) amplified from genomic DNA from the infertile patient harboring the TEX11 mutation and 288 fertile men in a 25 μl reaction using the following conditions: 95°C for 5 min, 35 cycles of 95°C for 30 s, 60°C for 30 s and 72°C for 40 s. Forward and reverse primers were F 5'-AACAAGTGACTCCCAAAGAATGC-3' and R 5'-ACAGGTGAGAAAACTGAAGCCTG-3', respectively. The PCR-amplified products were purified using an Avanti J-20 XP centrifuge (Beckman Coulter, Brea, CA, USA), and subsequent sequencing was completed with the use of a BigDye terminator kit with the ABI 3730-Avant Genetic Analyzer (Applied Biosystems, Shanghai, China). The results were compared with the TEX11 gene sequence using Sequencer software, version 4.9 (Gene Codes Corporation, Ann Arbor, MI, USA).

Plasmid construction

The open reading frame of human TEX11 cDNA (NM_031276) was amplified from a TEX11 clone plasmid (GeneCopoeia, Guangzhou, China). Quantitative real-time PCR (qPCR) was performed with the PrimeSTAR system (Takara, Beijing, China) using the following conditions: 98°C for 5 min, 30 cycles of 98°C for 10 s, 60°C for 5 s and 72°C for 90 s. Forward and reverse primers were F 5'- GCCAGATCTCAAGCTATGCATCATCACCATCACCATGACA -3' and R 5'- TGAGTTTCTGCTCGACTAATCTGACTTGCTCCAGTAG -3', respectively. This pair of primers contained a 6*histone (His) tag sequence, thus a 6*His-TEX11 sequence with a 6*His tag added before the TEX11 sequence were obtained after PCR with this pair of primers. The mutant expression vector for p.D51fs was generated with a Quikchange Lightning Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA), and DNA sequencing was conducted to confirm the desired mutation. The wild-type vector and mutant vector were constructed by inserting wild-type and mutant TEX11 cDNA directly into a PCMV6 vector (Origene, Beijing, China), respectively.

Cell culture and transfection

Human embryonic kidney 293 (HEK293) cells (National Collection of Authenticated Cell Cultures, Beijing, China) were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, Beijing, China) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin-streptomycin at 37°C in the 5% CO2 atmosphere. For confirmatory experiments, the desired plasmids (mock vector, wild-type TEX11, or p.D51fs mutant plasmids) were transiently transfected into cells using X-tremeGENE HP DNA Transfection Reagent (Roche, Basel, Switzerland). HEK293 cells were seeded in a 10-cm dish for 24 h to grow to 70%–80% confluence and were then transfected with 10 μg of the various plasmids.

Western blotting

Forty-eight hours after transfection, cells were lysed in lysis buffer (50 mmol l−1 HEPES-KOH, pH 7.5, 100 mmol l−1 KCl, 2 mmol l−1 ethylenediaminetetraacetic acid (EDTA), 10% glycerol, 0.1% NP-40, 10 mmol l−1 NaF, 0.25 mmol l−1 Na3VO4, 50 mmol l−1 β-glycerolphosphate), with protease inhibitors (Roche) for 20 min on ice, followed by centrifugation at 13 000g (Eppendorf 5424R, Shanghai, China) for 25 min at 4°C. Equal amounts of protein (assessed via bicinchoninic acid [BCA]) were electrophoresed on 10% sodium dodecyl sulfate polyacrylamide gels and were transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). The membranes were blocked and then incubated with primary mouse monoclonal anti-His antibody (1:5000 diluted; Proteintech, Chicago, IL, USA). Immunoblots were imaged with a BIO-RAD ChemiDoc MP Imaging System (Bio-Rad, Hercules, CA, USA) and analyzed using Image Lab Software (Bio-Rad).


  Results Top


A novel azoospermia phenotype-associated mutation in the TEX11 gene

We conducted an analysis of 40 azoospermic men using WES. All of the infertile patients of the study were prescreened for the lack of chromosomal abnormalities and Y-chromosomal microdeletions. The WES results revealed a novel deletion mutation from site 151 to 154 of the TEX11 isoform 2 transcript (NM_031276) in one patient with meiotic arrest [Figure 1]a. [Table 1] lists all of the previously reported TEX11 mutations as well as the novel mutation we identified in the present study.[9] To verify the mutation, the infertile patient with the TEX11 mutation and 288 fertile men were examined via Sanger sequencing. The deletion mutation in the patient was confirmed; none of the 288 control men carried the novel variant [Figure 1]b. Since TEX11 is an X-linked germ-cell specific gene, it is likely to be associated with spermatogenic failure. The frame-shift mutation in exon 3 c.151_154del (p.D51fs) was predicted to result in a premature stop codon in exon 4, resulting in a truncated protein comprising only 57 amino acids [Figure 1]c.
Figure 1: A novel frame-shift mutation identified in the TEX11 gene. (a) The TEX11 c.151_154del mutation is localized in exon 3 (red arrow), and the premature stop codon is localized in exon 4 of TEX11 transcript isoform 2 (NM_031276.3). White rectangles represent noncoding exons, and black rectangles represent coding exons. The coding sequence of the gene begins a start codon in exon 2 and ends at a stop codon in exon 30. (b) Sanger sequencing validation of the identified deletion mutation in the patient. (c) Predicted TEX11 domains with a SPO22 meiosis-specific motif (amino acid positions 175–402) and multiple TPR-containing regions (amino acid positions 402–436 and 441–471). The mutation in the coding region is located in the N-terminal sequence (red arrow). A predicted protein length schematic of truncated protein variant comprising 57 N-terminal amino acids is shown under the predicted protein domains for TEX11. TEX11: testisexpressed 11; SPO22: sporulation domain; TPR: tetratricopepetide repeat; WT: wild type; AA: amino acid.

Click here to view
Table 1: Mutations of TEX11 reported for azoospermia patients in published literature and our dataa

Click here to view


Meiotic arrest in the azoospermia patient bearing the p.D51fs TEX11 mutation

The detailed phenotypes of the azoospermic patient with the p.D51fs TEX11 mutation were ascertained through semen analysis and histologic examination of testicular biopsy specimens using light microscopy. No sperm was found in three separate semen analyses or in testicular biopsy sections. The patient was 25 years old, with normal endocrine hormone levels [Table 2]. The karyotype of the patient was normal (46,XY), and no Y chromosome microdeletions were detected [Table 2]. Histological analysis of the fertile man's testis biopsy showed spermatids and different stages of male germ cells [Figure 2]a,[Figure 2]b,[Figure 2]c. In comparison, the patient's testis biopsy revealed meiotic arrest at pachytene stage in most seminiferous tubules; round spermatids were observed only rarely in tubules (arrows; [Figure 2]d,[Figure 2]e,[Figure 2]f). No mature spermatozoa were observed in the seminiferous tubules, in accordance with the diagnosis of azoospermia. Postmeiotic cells were not seen in most tubules of the azoospermia patient, although we did detect a few late spermatocytes and round spermatids in rare tubules. Based on the histological analysis, the primary defect caused by the TEX11 deletion mutation of this patient was concluded to be meiotic arrest.
Figure 2: Hematoxylin and eosin staining of the testicular biopsy of the patient and fertile control. (a) Testis sections from a fertile control man and expanded view of one seminiferous tubule in (b) the left square and (c) the right square, with marked mature sperm (arrowhead) and different stages of developing male germ cells (including pachytene spermatocytes [asterisk] and round sperm cells [arrow]). (d) The azoospermia patient and expanded view of one seminiferous tubule in (e) the left square and (f) the right square, with meiosis arrested at the pachytene stage (asterisk) in most of the seminiferous tubules; round spermatids (arrow) were observed only rarely. TEX11: testis-expressed 11.

Click here to view
Table 2: Clinical data of the analyzed TEX11 mutation-bearing azoospermic patient

Click here to view


TEX11 protein expression in a healthy control and the azoospermia patient

IHC analysis of testis sections from the fertile control man showed that TEX11 was mainly expressed in late-pachytene spermatocytes and in round spermatids; TEX11 was completely absent in surrounding somatic cells including Sertoli cells and interstitial cells [Figure 3]a. However, no TEX11 expression was detected in the azoospermia patient with the TEX11 mutation [Figure 3]b. We also conducted experiments wherein Western blotting was used to assess TEX11 protein accumulation in HEK293 cells, which were transiently transfected with expression vectors including an empty control (PCMV6), a fusion construct of the wild-type TEX11 coding sequence (CDS) with a terminal His tag [Figure 3]c, and a fusion construct of the CDS for the p.D51fs mutant allele with a His tag. Normal His-TEX11 was detected as expected (approximately 107 kDa) from cells expressing wild-type TEX11; while no such band was detected from cells transfected with the empty control or the p.D51fs mutant sequence [Figure 3]d.
Figure 3: Expression of wild-type TEX11 and the p.D51fs truncation mutant variant in human testis and HEK293 cells. (a) Immunohistochemical detection of TEX11 in testicular tissue sections using a polyclonal anti-TEX11 antibody. In a control with normal spermatogenesis, TEX11 was highly expressed in late-pachytene spermatocytes and round spermatids. (b) In the patient, germ cells exhibited no staining for TEX11. (c) Schematic for the pCMV6-His-TEX11 vector used for cell transfection as wild-type TEX11-His. (d) Western blotting results stained for anti-His antibody with HEK293 cells transiently transfected with mock vector PCMV6, wild-type TEX11-His, or TEX11-mutant (p.D51fs)-His vectors. Actin served as a loading control, and molecular weight markers are shown on the left. SV40: simian virus 40; CMV: cytomegalovirus; f1: F1 phage; ori: origin; AmpR: ampicillin resistance gene; M13 fwd: enterobacteria phage M13 forward; T7: promoter for bacteriophage T7 RNA polymerase; His: histone; TEX11: testis-expressed 11; FLAG: DYKDDDDK amino acid sequence tag; Myc: EQKLISEEDL amino acid sequence tag; M13 rev: enterobacteria phage M13 reverse; hGH poly(A): human growth hormone polyadenylation; HSV TK poly(A): herpes simplex virus-thymidine kinase polyadenylation; NeoR/KanR: neomycin/kanamycin resistance gene; pCMV6: plasmid CMV6.

Click here to view



  Discussion Top


The TEX11 protein is required for chromosomal synapsis, repair of DNA double-strand breaks, meiotic crossover, and recombination.[21],[22],[25] Specifically, previous work has shown that TEX11 forms distinct foci on homologous chromosomes that synapse with each other, apparently forming components of meiotic nodules that are needed for recombination: Tex11-null mice with exon 3–29 knocked out exhibit meiotic arrest and spermatocytes deletion,22 and this phenotype is consistent with our study. However, Adelman and Petrini[21] figured out that exon 3 knockout male mice were fertile with the production of normal litter sizes.[21] As was stated above, the phenotypes of Tex11-null mice were not in accordance in different kinds of Tex11-knockout mice, and we suppose this may result from knockout of a different exon.

The well-studied TEX11 protein contains a meiosis-specific sporulation (SPO22) domain (175–429 AA) and numerous tetratricopeptide repeat (TPR) containing regions (402–436 AA, 441–471 AA) that have been shown to mediate protein–protein interactions.[19],[20] In Saccharomyces cerevisiae and Arabidopsis thaliana, zinc transporter 4 precursor (Zip4), an ortholog of TEX11, physically interacts with ZMM (abbreviation for Zip1/2/3/4, Msh4/5, and Mer3) proteins and with the axial element of the synaptonemal complex (SC), providing a direct physical link between crossover-designated recombination intermediates and SC assembly.[21],[26] Previous studies have reported that full-length mouse TEX11 interacts with synaptonemal complex protein 2 (SYCP2),[22] and the C-terminal portion of human TEX11 is known to interact with both shortage in chiasmata 1 (SHOC1, also known as ZIP2) and nijmegen breakage syndrome 1 (NBS1)[4],[21] that are involved in meiotic synapsis, repair, and crossover formation. However, we are unaware of any studies reporting any dysfunction related to the N-terminal region of TEX11. In addition, mutations previously reported in human were either single base replacement or bases deletion and insertion from exon 6 to exon 29.[9],[10],[20] Therefore, the TEX11 c.151_154del mutation in exon 3 found in our study was the first reported mutation on the N-terminal region of human TEX11.

Yang et al.[10] reported that the frequency of rare TEX11 mutations is significantly elevated in azoospermic men, suggesting that TEX11 may function in human spermatogenesis.[10] Mutations in this single X-linked gene cause infertility in 1% of azoospermic men.[10],[20],[27] Our study identified a TEX11 mutation in infertile patients with meiotic arrest, representing a 2.5% incidence. Our study therefore supports previously published data that it would be beneficial to include the TEX11 gene in genetic screening panels for the clinical evaluation of azoospermia patients. One deficiency of the present study is that we were unable to explore the inheritance of the mutation, because the proband's family declined to participate in the study. It will be helpful to further explore the relative incidence of this TEX11 mutation in azoospermia in larger and more diverse cohorts. In conclusion, we identified a novel (p.D51fs) mutation in the TEX11 gene of an azoospermia patient and demonstrated that the genetic disruption of TEX11 is causative for azoospermia.


  Author Contributions Top


MJL, HBL, and HBZ carried out the genetic studies and participated in the WES analysis. XCY, FFC, and SJY carried out the histological experiment. XCY and MJL carried out in vitro protein expression experiment. XCY, HBL, and HBZ drafted the manuscript. MJL, HBL, and HBZ conceived of the study and participated in its design and coordination. All authors read and approved the final manuscript.


  Competing Interests Top


All authors declared no competing interests.


  Acknowledgments Top


This work was supported by the Key Research and Development Program of Shandong Province (2019GSF108237), the Young Scholars Program of Shandong University (2016WLJH50), and the Natural Science Foundation of Shandong Province (ZR2017MH049).



 
  References Top

1.
Agarwal A, Mulgund A, Hamada A, Chyatte MR. A unique view on male infertility around the globe. Reprod Biol Endocrinol 2015; 13: 37.  Back to cited text no. 1
    
2.
Di Spiezio Sardo A, Di Carlo C, Minozzi S, Spinelli M, Pistotti V, et al. Efficacy of hysteroscopy in improving reproductive outcomes of infertile couples: a systematic review and meta-analysis. Hum Reprod Update 2016; 22: 479–96.  Back to cited text no. 2
    
3.
de Kretser DM. Male infertility. Lancet 1997; 349: 787–90.  Back to cited text no. 3
    
4.
Ghieh F, Mitchell V, Mandon-Pepin B, Vialard F. Genetic defects in human azoospermia. Basic Clin Androl 2019; 29: 4.  Back to cited text no. 4
    
5.
Meistrich ML, Hess RA. Assessment of spermatogenesis through staging of seminiferous tubules. Methods Mol Biol 2013; 927: 299–307.  Back to cited text no. 5
    
6.
Gudeloglu A, Parekattil SJ. Update in the evaluation of the azoospermic male. Clinics (Sao Paulo) 2013; 68 Suppl 1: 27–34.  Back to cited text no. 6
    
7.
Krausz C, Riera-Escamilla A. Genetics of male infertility. Nat Rev Urol 2018; 15: 369–84.  Back to cited text no. 7
    
8.
Plaseska-Karanfilska D, Noveski P, Plaseski T, Maleva I, Madjunkova S, et al. Genetic causes of male infertility. Balkan J Med Genet 2012; 15: 31–4.  Back to cited text no. 8
    
9.
Sha Y, Zheng L, Ji Z, Mei L, Ding L, et al. A novel TEX11 mutation induces azoospermia: a case report of infertile brothers and literature review. BMC Med Genet 2018; 19: 63.  Back to cited text no. 9
    
10.
Yang F, Silber S, Leu NA, Oates RD, Marszalek JD, et al. TEX11 is mutated in infertile men with azoospermia and regulates genome-wide recombination rates in mouse. EMBO Mol Med 2015; 7: 1198–210.  Back to cited text no. 10
    
11.
Esteves SC. Clinical management of infertile men with nonobstructive azoospermia. Asian J Androl 2015; 17: 459–70.  Back to cited text no. 11
    
12.
Hamada AJ, Esteves SC, Agarwal A. A comprehensive review of genetics and genetic testing in azoospermia. Clinics (Sao Paulo) 2013; 68 Suppl 1: 39–60.  Back to cited text no. 12
    
13.
Cocuzza M, Alvarenga C, Pagani R. The epidemiology and etiology of azoospermia. Clinics (Sao Paulo) 2013; 68 Suppl 1: 15–26.  Back to cited text no. 13
    
14.
Fisch H, Lambert SM, Goluboff ET. Management of ejaculatory duct obstruction: etiology, diagnosis, and treatment. World J Urol 2006; 24: 604–10.  Back to cited text no. 14
    
15.
Clements KM, Shipley CF, Coleman DA, Ehrhart EJ, Haschek WM, et al. Azoospermia in an 8-month-old boar due to bilateral obstruction at the testis/epididymis interface. Can Vet J 2010; 51: 1130–4.  Back to cited text no. 15
    
16.
Schoysman R, Vanderzwalmen P, Nijs M, Segal L, Segal-Bertin G, et al. Pregnancy after fertilisation with human testicular spermatozoa. Lancet 1993; 342: 1237.  Back to cited text no. 16
    
17.
Gassei K, Orwig KE. Experimental methods to preserve male fertility and treat male factor infertility. Fertil Steril 2016; 105: 256–66.  Back to cited text no. 17
    
18.
Krausz C. Male infertility: pathogenesis and clinical diagnosis. Best Pract Res Clin Endocrinol Metab 2011; 25: 271–85.  Back to cited text no. 18
    
19.
Stouffs K, Lissens W. X chromosomal mutations and spermatogenic failure. Biochim Biophys Acta 2012; 1822: 1864–72.  Back to cited text no. 19
    
20.
Yatsenko AN, Georgiadis AP, Ropke A, Berman AJ, Jaffe T, et al. X-linked TEX11 mutations, meiotic arrest, and azoospermia in infertile men. N Engl J Med 2015; 372: 2097–107.  Back to cited text no. 20
    
21.
Adelman CA, Petrini JH. ZIP4H (TEX11) deficiency in the mouse impairs meiotic double strand break repair and the regulation of crossing over. PLoS Genet 2008; 4: e1000042.  Back to cited text no. 21
    
22.
Yang F, Gell K, van der Heijden GW, Eckardt S, Leu NA, et al. Meiotic failure in male mice lacking an X-linked factor. Genes Dev 2008; 22: 682–91.  Back to cited text no. 22
    
23.
World Health Orgernazation. WHO Laboratory Manual for the Examination and Processing of Human Semen. 5th ed. Geneva: WHO Press; 2010. p56–102.  Back to cited text no. 23
    
24.
Wang PJ, McCarrey JR, Yang F, Page DC. An abundance of X-linked genes expressed in spermatogonia. Nat Genet 2001; 27: 422–6.  Back to cited text no. 24
    
25.
Dapper AL, Payseur BA. Molecular evolution of the meiotic recombination pathway in mammals. Evolution 2019; 73: 2368–89.  Back to cited text no. 25
    
26.
Zhang Q, Shao J, Fan HY, Yu C. Evolutionarily-conserved MZIP2 is essential for crossover formation in mammalian meiosis. Commun Biol 2018; 1: 147.  Back to cited text no. 26
    
27.
Jedidi I, Ouchari M, Yin Q. Sex chromosomes-linked single-gene disorders involved in human infertility. Eur J Med Genet 2019; 62: 103560.  Back to cited text no. 27
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1], [Table 2]



 

 
Top
 
 
  Search
 
 Search Pubmed for
 
    -  Yu XC
    -  Li MJ
    -  Cai FF
    -  Yang SJ
    -  Liu HB
    -  Zhang HB
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Patients and Methods
Results
Discussion
Author Contributions
Competing Interests
Acknowledgments
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed824    
    PDF Downloaded52    

Recommend this journal